rs6008055 chr22:47169663 C>T
- Sequence
tggagaaaggcagggtgcactcca[C/T]gctgccctctggctgtggctttgt
- ASB in cell types
- HCT-116 (colon carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | -0.27 | 0.98 | 1.06 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -3.79 | 2.13 | 1.17 |
Items per page:
1 – 2 of 2