rs6016483 chr20:40968853 A>G
- Sequence
attaacccaagtcattggttgagt[A/G]tgaaggcatggagcccccacggcc
- ASB in cell types
- neutrophils from periferal blood K562 (myelogenous leukemia) HepG2 (hepatoblastoma) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.65 | 2.68 | 2.50 | |||
| K562 (myelogenous leukemia) | 0.19 | 0.75 | 1.99 | |||
| HepG2 (hepatoblastoma) | 0.42 | 0.84 | 1.12 | |||
| Kelly (neuroblastoma) | 0.12 | 1.07 | 1.69 | |||
| H929 (plasma cell myeloma) | n/a | 1.11 | 2.00 |
Items per page:
1 – 5 of 6