rs6019580 chr20:49009368 T>C
- Sequence
aagccagataaaatttgaaagtca[T/C]gagcctgggaggcagaggttgcaa
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- RARA_HUMAN FOXA1_HUMAN TFE3_HUMAN SOX13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -4.40 | 3.08 | 1.33 | -0.39 | Weak Discordant | |||
| FOXA1_HUMAN | 0.04 | 1.06 | 2.44 | n/a | No Hit | |||
| TFE3_HUMAN | n/a | 2.65 | 1.50 | 3.57 | Concordant | |||
| SOX13_HUMAN | -3.18 | 2.18 | 1.50 | n/a | No Hit | |||
| TEAD1_HUMAN | -4.61 | 2.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, height, infant head circumference, ldl cholesterol, sarcoidosis, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood