rs6022863 chr20:53939884 A>G
- Sequence
cacaaaccaaccaaccttatcttc[A/G]tttggaggactgagaatcatagaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC1_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 2.37 | 0.50 | 2.00 | n/a | n/a | |||
| RFX1_HUMAN | 2.58 | -1.59 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, chronic kidney disease, cystatin c in serum, diastolic blood pressure (dbp), systolic blood pressure (sbp), years of education