rs6026574 chr20:58881440 T>A
- Sequence
gaagggattgaggaaagcttcctc[T/A]gtgataagtcttggcttggcaaaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- LMBL2_HUMAN RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | -5.22 | 3.04 | 2.00 | n/a | n/a | |||
| RING2_HUMAN | n/a | 3.27 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, cystatin c in serum, fasting blood glucose, height, irritible bowel syndrome, mitral annular calcium
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid