rs6037233 chr20:2647074 T>C
- Sequence
aaagtgccgccctcttgtggtagt[T/C]tcatgaaatttcctttcccgaagc
- ASB in cell types
- tibial artery GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte testis
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial artery | 2.46 | -2.18 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.03 | 0.88 | 1.03 | |||
| foreskin keratinocyte | 0.49 | n/a | 2.33 | |||
| testis | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis