rs6050202 chr20:24955265 A>C
- Sequence
aaggagctgcctttggctctgggg[A/C]cccctccttcctgatggtaacact
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) Th1-cells
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.19 | 1.48 | 1.39 | 2.32 | Concordant | |||
| STAG1_HUMAN | -0.43 | 1.74 | 1.27 | n/a | n/a | |||
| TBX21_HUMAN | -0.07 | 1.96 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood