rs6053197 chr20:5202707 G>T
- Sequence
agaacagactacagtgggccaagg[G/T]tgaaagcagggtgatcagagagga
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.64 | -2.81 | 1.50 | -2.31 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), prop taste detection threshold, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Nerve_Tibial, Thyroid, Whole_Blood