rs6056021 chr20:8690295 A>G
- Sequence
acactgagaacagcaggtgttaca[A/G]cagagaaagtttacttattgcaag
- ASB in cell types
- CD34+ hematopoietic stem cells WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | -0.59 | 2.34 | 1.20 | n/a | n/a |
Items per page:
1 – 1 of 1