rs6056062 chr20:8751754 T>C
- Sequence
actgaagtactaccaccttctgaa[T/C]cttctttccttgataattgcttaa
- ASB in cell types
- LUHMES (lund human mesencephalic cells) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | -1.08 | 1.57 | 1.00 | |||
| glioblastoma cells | n/a | 1.50 | 2.50 |
Items per page:
1 – 2 of 2