rs6056182 chr20:953974 C>T
- Sequence
cacacggggacagcgctgagccga[C/T]gacacggcagtgccgctctggaca
- ASB in cell types
- foreskin keratinocyte epithelial cell of prostate HepG2 (hepatoblastoma) IMR-5 (Neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN TEAD3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.61 | 0.25 | 1.57 | n/a | No Hit | |||
| TEAD3_HUMAN | 2.83 | -2.56 | 1.00 | n/a | No Hit | |||
| RAD21_HUMAN | 2.34 | -3.79 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, body mass index (bmi), eye color, prop taste detection threshold, refractive error, total cholesterol, waist hip ratio