rs61776665 chr1:37888601 A>G
- Sequence
cattcccacttcctttaaacagcc[A/G]ttacccaggcattatctgcataat
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) Jurkat (T-cells) PF-382 (childhood T acute lymphoblastic leukemia)
- ASB for transcription factors
- MYB_HUMAN CDK9_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYB_HUMAN | -0.16 | 2.46 | 1.50 | 5.04 | Concordant | |||
| CDK9_HUMAN | n/a | 4.12 | 1.00 | n/a | n/a | |||
| KDM6A_HUMAN | -1.20 | 1.20 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood