rs62118399 chr2:1589315 A>C
- Sequence
gtgtgtgcggatgcattggcctcc[A/C]gccccgggcagcggcatgtccgtg
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -4.79 | 2.70 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -2.25 | 1.05 | 1.33 |
Items per page:
1 – 2 of 2