rs62120501 chr2:3422510 G>A
- Sequence
tgagaagaaggaacagctgcaaac[G/A]ttgatacattcttacctttccctg
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NALM-6 (adult B acute lymphoblastic leukemia) | 1.50 | 0.80 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid