rs62125125 chr19:6761272 G>C
- Sequence
ctatgggaaatatccagacctggc[G/C]cataaaaccctgctgcacaatctt
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.77 | -5.29 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid