rs62125882 chr19:3172916 T>C
- Sequence
gggatgcctgtgccccgcatggga[T/C]gcctgcattctcatgggacacctg
- ASB in cell types
- HT1080 (fibrosarcoma) SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN SSRP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 1.86 | n/a | 2.00 | 3.49 | Discordant | |||
| SSRP1_HUMAN | 2.63 | -2.67 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Lung, Thyroid