rs62126354 chr19:55279723 C>T
- Sequence
gggtctgctgagaaggcggcgttt[C/T]aggggagctcggcgaccccccatg
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | n/a | 2.03 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Nerve_Tibial, Stomach, Thyroid