rs62128258 chr19:55477497 C>T
- Sequence
agttcttggctaggcgcggtggct[C/T]acgcctgtaatcccagcactttgg
- ASB in cell types
- K562 (myelogenous leukemia) D283 Med (medulloblastoma)
- ASB for transcription factors
- E4F1_HUMAN OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E4F1_HUMAN | n/a | 3.47 | 2.00 | 4.19 | Concordant | |||
| OTX2_HUMAN | -2.60 | 2.55 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Esophagus_Mucosa, Lung, Nerve_Tibial, Spleen, Testis