rs62128778 chr19:1194695 C>G
- Sequence
ccgccacctggcggccacagcggt[C/G]cgcgcagaccgccggccccttttc
- ASB in cell types
- WA09 (embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line) erythroid progenitors MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.40 | -0.00 | 1.32 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.76 | 0.74 | 1.10 | |||
| erythroid progenitors | -4.48 | 2.02 | 2.00 | |||
| MDM(monocyte derived macrophages) | 1.45 | 0.14 | 1.67 |
Items per page:
1 – 4 of 4