rs62130566 chr19:3440336 T>C
- Sequence
ccccagacctggccaaatgtctct[T/C]gcgggcagaatctcccctataata
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GBM39 (Human brain tumor) neutrophils from periferal blood GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KAISO_HUMAN | n/a | 3.06 | 2.00 | 4.15 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
