rs62130906 chr19:56638093 G>A
- Sequence
gaacgctaatgcttgaatggttta[G/A]aactgcggacagctcacgccagac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CRC107 (colorectal cancer metastatic stem cells) PFSK1 (primitive neuroectodermal tumor) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ZBT40_HUMAN REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT40_HUMAN | 3.21 | -2.88 | 1.00 | n/a | No Hit | |||
| REST_HUMAN | 1.38 | 0.24 | 1.45 | -3.22 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Frontal_Cortex_BA9, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial