rs62141131 chr2:28356414 A>G
- Sequence
accttgggcctggcagtccagctc[A/G]gagtcctgtcctgccttcactctg
- ASB in cell types
- K562 (myelogenous leukemia) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.07 | 0.76 | 2.00 | |||
| breast tumor | 2.34 | -1.38 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis