rs62144962 chr2:31428176 T>G
- Sequence
ccacctggaggcccagacaagagg[T/G]ggctctgccctgggtctgctcttt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) HT1080 (fibrosarcoma) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.40 | -0.12 | 1.27 | 0.72 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
