rs62154653 chr2:102046359 A>G
- Sequence
gtgtttatcccacaccatgcacac[A/G]tctcccaatcaatcactgtgcctc
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CFPAC-1(pancreatic ductal adenocarcinoma) | 1.05 | -0.13 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.87 | -4.00 | 3.00 |
Items per page:
1 – 2 of 2