rs62159869 chr2:118855541 A>G
- Sequence
atcgcgccccctaggggtgacccc[A/G]gtgggtcccgtgtgctctccgcgg
- ASB in cell types
- A549 (lung carcinoma) upper lobe of left lung IMR-5 (Neuroblastoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- RAD21_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.45 | 1.15 | 1.76 | n/a | n/a | |||
| SMC3_HUMAN | 0.38 | 1.09 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2