rs62160581 chr2:128063521 T>G
- Sequence
aatctccaaccaaccaacctcatt[T/G]gtaggagaggtcatcccagagaga
- ASB in cell types
- CD34+ stem cells-derived erythroblasts neural cell GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.84 | n/a | 2.00 | |||
| neural cell | 1.26 | -0.41 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 0.36 | 1.19 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg