rs62165986 chr2:76434380 G>C
- Sequence
taacttttattttcacagagaatt[G/C]ttatcccttcttcacggctcacca
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -1.83 | 3.03 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1