rs62178345 chr2:199911630 T>G
- Sequence
gctttccaccgtgcctggagccga[T/G]ccgcagcgcagcaacgaattgctc
- ASB in cell types
- HepG2 (hepatoblastoma) primary B-CLL cells
- ASB for transcription factors
- RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | 1.88 | -0.96 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cortex, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Testis, Thyroid