rs62183550 chr2:171521274 T>C
- Sequence
gggtaggagctttatgctgaacag[T/C]ttggccaaacatacatacgtaaca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.64 | 0.95 | 1.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis