rs62186337 chr2:212613441 G>A
- Sequence
ctaattatcagagaaatgcaaatc[G/A]aaaccacaaggagctatcatctca
- ASB in cell types
- NCI-H209 (Small cell lung carcinoma. Derived from metastatic site: Bone marrow)
- ASB for transcription factors
- NKX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NKX21_HUMAN | 2.43 | -0.31 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1