rs62200183 chr20:20303769 C>T
- Sequence
tcatttgcgcacttccatccacca[C/T]gtctggggcacctacctcagtgcc
- ASB in cell types
- THP-1 (acute monocytic leukemia) MDM(monocyte derived macrophages) CD14+ monocytes monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.25 | 0.11 | 1.89 | n/a | No Hit | |||
| STAT1_HUMAN | 2.36 | -0.47 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2