rs62201400 chr20:38926124 G>A
- Sequence
cctggccttgcacggccgcgcagc[G/A]gggcgaccggcagggggcgcgctg
- ASB in cell types
- glioblastoma cells HMEC (human mammary epithelial cells) thyroid gland Kasumi-1 (acute myeloblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | n/a | 2.75 | 2.50 | |||
| HMEC (human mammary epithelial cells) | -0.60 | 2.23 | 1.00 | |||
| thyroid gland | -0.45 | 1.96 | 1.00 | |||
| Kasumi-1 (acute myeloblastic leukemia) | 0.26 | 2.83 | 1.25 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Stomach