rs62201522 chr20:38322086 T>C
- Sequence
ggaacatctttgccatccatgaaa[T/C]gtcctcttgcagccctttactggc
- ASB in cell types
- uterus THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| uterus | 2.48 | -2.17 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.46 | 0.85 | 1.00 |
Items per page:
1 – 2 of 2