rs62204028 chr20:5529795 C>A
- Sequence
gagagaacctgcttccctgacggc[C/A]cacactcccccggcacacaaggct
- ASB in cell types
- neutrophils from periferal blood HeLa S3 (cervical adenocarcinoma) erythroid progenitors
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 3.62 | 1.65 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1