rs62204582 chr20:44747627 G>A
- Sequence
cctggttctttacctctgaggtac[G/A]tctgggaggctgatgtaagagact
- ASB in cell types
- foreskin keratinocyte GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.92 | n/a | 2.33 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 0.98 | 0.26 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic