rs62204968 chr20:61874921 C>T
- Sequence
cagcgccactttctggcagctcct[C/T]ggtcttgctggcctcaacccttct
- ASB in cell types
- glioblastoma cells HCT-116-RAD21-mAC
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -2.52 | 4.11 | 2.00 | |||
| HCT-116-RAD21-mAC | 1.67 | -0.43 | 1.00 |
Items per page:
1 – 2 of 2