rs62214354 chr21:45591158 T>C
- Sequence
ggcgctggagcatttccaggtcgt[T/C]atagggcccggccgcgtggggacc
- ASB in cell types
- K562 (myelogenous leukemia) GM19239 (male B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.17 | -0.66 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Pancreas, Whole_Blood