rs62217749 chr21:10674950 A>G
- Sequence
cttcccttccattccattgctttc[A/G]ggtcctttccattccgtagaattc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.02 | 1.50 | 4.20 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.18 | 1.18 | 3.31 |
Items per page:
1 – 2 of 2