rs62230488 chr3:24684012 A>G
- Sequence
gccacattttcattcaattgtgcc[A/G]gatctcaatagtcatttctacaaa
- ASB in cell types
- T47D (invasive ductal carcinoma) GM18486 (Lymphoblastoid Cell Lines) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.10 | 1.28 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.40 | 1.25 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.26 | 0.34 | 2.00 |
Items per page:
1 – 3 of 3