rs62231810 chr3:14377905 C>A
- Sequence
actgaaggggactgacctgtgtga[C/A]ccataggatattgcagaaatgatg
- ASB in cell types
- CD14+ monocytes macrophages form periferal blood monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.47 | -0.36 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.90 | 0.31 | 1.91 | n/a | No Hit |
Items per page:
1 – 2 of 2