rs62236293 chr3:16378328 G>C
- Sequence
tttaactatattgtctgatggaaa[G/C]ataaagcatttggctttgaagagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.59 | 1.56 | 1.04 | n/a | No Hit |
Items per page:
1 – 1 of 1