rs62245468 chr3:71985278 T>C
- Sequence
cttgtgaggtagactattattatc[T/C]ctaatttacaaaggaggcaaatga
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) germinal center B-cells Th1-cells
- ASB for transcription factors
- STAG1_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.26 | 0.48 | 1.06 | n/a | n/a | |||
| MEF2B_HUMAN | -1.74 | 2.53 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2