rs62253290 chr3:73086104 G>T
- Sequence
tgaagaaagagattaagaataaaa[G/T]tcccagagttttgcactgtcccca
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.31 | 1.18 | 1.98 | |||
| foreskin keratinocyte | 0.69 | n/a | 2.67 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.61 | 0.71 | 1.07 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid