rs62253670 chr3:55900122 G>A
- Sequence
agattatactggttataatccggt[G/A]gggagagcccaattgttggtgact
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 2.87 | -2.54 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -1.12 | 1.66 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.31 | -1.18 | 1.00 |
Items per page:
1 – 3 of 3