rs62263392 chr3:126213121 C>G
- Sequence
cggaggcccggcctctcgcctccc[C/G]accctccccaccctccccgcgcct
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) HEK293T (embryonic kidney) pancreas upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.39 | 1.65 | 1.38 | n/a | No Hit | |||
| LMBL2_HUMAN | n/a | 3.12 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid