rs62264109 chr3:127547901 C>A
- Sequence
ccctccccttccggagcccggccc[C/A]gcgcgccgccatgcctggtgccgc
- ASB in cell types
- spleen MCF7 (Invasive ductal breast carcinoma) WA09 (embryonic stem cells) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | -0.59 | 2.73 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.29 | 0.73 | 1.38 | |||
| WA09 (embryonic stem cells) | 1.63 | 0.15 | 1.43 | |||
| Peyer's patch | -0.65 | 1.33 | 1.00 |
Items per page:
1 – 4 of 4