rs62265761 chr3:127694526 G>A
- Sequence
gctagctctggcagctcccttcac[G/A]gatcaggctctgccaagtcctgcc
- ASB in cell types
- right lobe of liver esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| right lobe of liver | 2.67 | -2.41 | 1.00 | |||
| esophagus squamous epithelium | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid