rs62270208 chr3:125603611 G>A
- Sequence
atgtactccacacaatattgtggg[G/A]tattagtaggtgttacttgattta
- ASB in cell types
- thyroid gland adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | -1.64 | 2.19 | 1.00 | |||
| adrenal gland | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood