rs62271065 chr3:115819928 T>C
- Sequence
catttttgaaaatgtggttatgtg[T/C]tgccatcttgtggtaatactaaga
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) transverse colon Peyer's patch upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.41 | 0.93 | 1.09 | 1.46 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
