rs62282451 chr3:133663997 T>C
- Sequence
agcagagagggtctgtctctagta[T/C]ctactcctggaaaatggataaagc
- ASB in cell types
- adrenal gland FT282 (normal human fallopian tube tissue) adult erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -2.43 | 2.54 | 1.00 | |||
| FT282 (normal human fallopian tube tissue) | 1.51 | -1.28 | 1.00 | |||
| adult erythroblasts | 1.78 | -1.18 | 1.00 |
Items per page:
1 – 3 of 3